View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_123 (Length: 282)
Name: NF1358_low_123
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_123 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 249
Target Start/End: Original strand, 24492886 - 24493121
Alignment:
| Q |
14 |
caccacagagcacatcggactagccgagcgtaaacaccgacacatcgttgaaacagctctcacactattaagtcatgcttccattccctcaaaatattgg |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24492886 |
caccccagagcacatcggactagccgagcataaacaccgacacatcgttgaaacagctctcacactattaagtcatgcttccattccctcaaaatattgg |
24492985 |
T |
|
| Q |
114 |
tgttatgcatttcaagcatctatatatcttattaatagaatgccaactcctttacttagtcacaaatcaccttttgaatgtcttcacaacaaacctccat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24492986 |
tgttatgcatttcaagcatctatatatcttattaatagaatgccaactcctttacttagtcacaaatcaccttttgaatgtcttcacaacaaacctccat |
24493085 |
T |
|
| Q |
214 |
cctataaaaatttcaaagtttttgggtgtctctgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24493086 |
cctataaaaatttcaaagtttttgggtgtctctgct |
24493121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 249
Target Start/End: Original strand, 92251 - 92486
Alignment:
| Q |
14 |
caccacagagcacatcggactagccgagcgtaaacaccgacacatcgttgaaacagctctcacactattaagtcatgcttccattccctcaaaatattgg |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
92251 |
caccccagagcacatcggactagccgagcgtaaacaccgacacattgttgaaacagctctcacaatattaagtcatgcttccattcccccaaaatattgg |
92350 |
T |
|
| Q |
114 |
tgttatgcatttcaagcatctatatatcttattaatagaatgccaactcctttacttagtcacaaatcaccttttgaatgtcttcacaacaaacctccat |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
92351 |
tgttatgcatttcaagcatctatatgtcttattaatagaatgccaactcctttacttagtcacaaatcaccttttgaatgtcttcacaacaatcctccat |
92450 |
T |
|
| Q |
214 |
cctataaaaatttcaaagtttttgggtgtctctgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
92451 |
cctataaaaatttcaaagtttttgggtgtctctgct |
92486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 104
Target Start/End: Original strand, 3729462 - 3729545
Alignment:
| Q |
21 |
gagcacatcggactagccgagcgtaaacaccgacacatcgttgaaacagctctcacactattaagtcatgcttccattccctca |
104 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3729462 |
gagcacatcggactagccgagtttaaacaccgacacattgttgaaacaactctcacactattaagtcatgcttccattccctca |
3729545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University