View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_124 (Length: 281)
Name: NF1358_low_124
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_124 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 48 - 281
Target Start/End: Complemental strand, 31536489 - 31536256
Alignment:
| Q |
48 |
aataaatatgacgcagcaataaaccaaccatccaattacaccatgcagataagaagcaagatagaccactcccttcttgatcactaaaacacatatataa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536489 |
aataaatatgacgcagcaataaaccaaccatccaattacaccatgcagataagaagcaagatagaccactcccttcttgatcactaaaacacatatataa |
31536390 |
T |
 |
| Q |
148 |
ttcatttcccactttgtccctccgacataccttgttcctaaatccaaacaaagccagccaccatggcaaccaccgcaaccgccgccaccatgtcacattt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536389 |
ttcatttcccactttgtccctccgacataccttgttcctaaatccaaacaaagccagccaccatggcaaccaccgcaaccgccgccaccatgtcacattt |
31536290 |
T |
 |
| Q |
248 |
tttcggcacaagtctctgcaaaccaacctcaaac |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31536289 |
tttcggcacaagtctctgcaaaccaacctcaaac |
31536256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University