View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_140 (Length: 256)
Name: NF1358_low_140
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_140 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 29 - 210
Target Start/End: Complemental strand, 33774405 - 33774220
Alignment:
| Q |
29 |
attttaaacgcaaaatagcaataagacaaa-ctaattaatgattaaaaaagacaatattttaagcnnnnnnnn-tactgaggagaattcttagagaattt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33774405 |
attttaaacgcaaaatagcaataagacaaaactaattaatgattaaaaaagacaatattttaagcaaaaaaaaatactgaggagaattcttagagaattt |
33774306 |
T |
 |
| Q |
127 |
ccacggatatgtagtaggtgaagctttcaaggtcaagtct--ttttatgaactattctctccgtctcataataactgagtcattta |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
33774305 |
ccacggatatgtagtaggtgaagctttgaaggtcaagtctttttttatgaactactccctccgtctcacaataactgagtcattta |
33774220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 33776289 - 33776219
Alignment:
| Q |
107 |
ggagaattcttagagaatttccacggatatgtagtaggtgaagctttcaaggtcaagtctttttatgaact |
177 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||| ||||||| |||| || |||||||| |||||| ||||||| |
|
|
| T |
33776289 |
ggagaatccttcgagaacttccacggatatgcagtaggtaaagccttgaaggtcaaatcttttaatgaact |
33776219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 209
Target Start/End: Complemental strand, 2842260 - 2842226
Alignment:
| Q |
175 |
actattctctccgtctcataataactgagtcattt |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2842260 |
actactctctccgtctcataataactgagtcattt |
2842226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 256
Target Start/End: Original strand, 41436019 - 41436054
Alignment:
| Q |
221 |
tgtttcaaagtaactgagtcatttcacttttcaata |
256 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41436019 |
tgtttcaaaataactgagtcatttcacttttcaata |
41436054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 256
Target Start/End: Original strand, 36784254 - 36784289
Alignment:
| Q |
221 |
tgtttcaaagtaactgagtcatttcacttttcaata |
256 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36784254 |
tgtttcaaaataactgagtcatttcacttttcaata |
36784289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 222 - 256
Target Start/End: Original strand, 28974248 - 28974282
Alignment:
| Q |
222 |
gtttcaaagtaactgagtcatttcacttttcaata |
256 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
28974248 |
gtttcaaaataactgagtcatttcacttttcaata |
28974282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University