View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_158 (Length: 227)
Name: NF1358_low_158
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_158 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 30464303 - 30464197
Alignment:
| Q |
8 |
aaaccacttagcaagaataaaactctatagtttccttatttaagtataccttgacttttctcttcccttgaggattcttagatttactcgatgatttcct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30464303 |
aaaccacttagcaagaataaaactctatagtttccttatttaagtataccttgacttttctcttcccttgaggatacttagatttactcgatgatttcct |
30464204 |
T |
 |
| Q |
108 |
tcctttt |
114 |
Q |
| |
|
||||||| |
|
|
| T |
30464203 |
tcctttt |
30464197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 145
Target Start/End: Complemental strand, 30464186 - 30464151
Alignment:
| Q |
110 |
cttttaacaatggattcacaaccacagattcatctc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30464186 |
cttttaacaatggattcacaaccacagattcatctc |
30464151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University