View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_163 (Length: 214)
Name: NF1358_low_163
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_163 |
 | |
|
| [»] scaffold0161 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 32457208 - 32457089
Alignment:
| Q |
1 |
ccgtcctttcccccaacactccggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457208 |
ccgtcctttcccccaacactccggccatgtacgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaa |
32457109 |
T |
|
| Q |
101 |
aaccctctccgttcatctca |
120 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
32457108 |
aaccctctccgttcttctca |
32457089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 32463927 - 32464040
Alignment:
| Q |
1 |
ccgtcctttcccccaacactccggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32463927 |
ccgtcctttcccccaacactccggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgactcgaccacaa |
32464026 |
T |
|
| Q |
101 |
aaccctctccgttc |
114 |
Q |
| |
|
|| |||||| |||| |
|
|
| T |
32464027 |
aagcctctctgttc |
32464040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 23351 - 23461
Alignment:
| Q |
1 |
ccgtcctttcccccaacactccggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaa |
100 |
Q |
| |
|
||||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||| |
|
|
| T |
23351 |
ccgtcctctctcccaacactccggccatgtacgagctacaattctccgttccaatgtccggcgccattctcaacaacctcagcttccgacttgactacaa |
23450 |
T |
|
| Q |
101 |
aaccctctccg |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
23451 |
aaccctctccg |
23461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University