View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1358_low_167 (Length: 210)

Name: NF1358_low_167
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1358_low_167
NF1358_low_167
[»] chr3 (1 HSPs)
chr3 (22-191)||(52365836-52366005)


Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 191
Target Start/End: Complemental strand, 52366005 - 52365836
Alignment:
22 cagagatcaaataaataatatatttggtgagtatgcatgtacgaataataatcaggttattaatgtgcaacaaacattttggatagatattcttaaagtt 121  Q
    |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
52366005 cagagatcaaataaataatataattggtgagtatgcatgtatgaataataatcaggttattcatgtgcaacaaacattttggatagatattcttaaagtt 52365906  T
122 aagattggaatcactcaactttacattactagcttgaaggtgagagaagtttcctacttataaacatata 191  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
52365905 aagataggaatcactcaactttacattactagcttgaaggtgagagatgtttcctacttataaacatata 52365836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University