View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_167 (Length: 210)
Name: NF1358_low_167
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_167 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 191
Target Start/End: Complemental strand, 52366005 - 52365836
Alignment:
| Q |
22 |
cagagatcaaataaataatatatttggtgagtatgcatgtacgaataataatcaggttattaatgtgcaacaaacattttggatagatattcttaaagtt |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52366005 |
cagagatcaaataaataatataattggtgagtatgcatgtatgaataataatcaggttattcatgtgcaacaaacattttggatagatattcttaaagtt |
52365906 |
T |
|
| Q |
122 |
aagattggaatcactcaactttacattactagcttgaaggtgagagaagtttcctacttataaacatata |
191 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52365905 |
aagataggaatcactcaactttacattactagcttgaaggtgagagatgtttcctacttataaacatata |
52365836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University