View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_169 (Length: 204)
Name: NF1358_low_169
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_169 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 40616919 - 40617007
Alignment:
| Q |
1 |
atatatattagccactacttgagtattctttcaagccatagtccatgtaactggtactacaccatcatttttattcagccgtaattcat |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40616919 |
atatatattagccactacttgagtattctttcaagccatagtccatgtaactggtactacaccatcatttttattcagccgtaattcat |
40617007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 77
Target Start/End: Original strand, 40627646 - 40627706
Alignment:
| Q |
16 |
tacttgagtattctttcaagccatagtccatgtaactggtactacaccatcatttttattca |
77 |
Q |
| |
|
|||||||||| | ||| ||||||||| |||||||||||||||||||||||||| | |||||| |
|
|
| T |
40627646 |
tacttgagtaattttt-aagccatagaccatgtaactggtactacaccatcatctgtattca |
40627706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University