View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_17 (Length: 594)
Name: NF1358_low_17
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 284 - 472
Target Start/End: Complemental strand, 45462054 - 45461866
Alignment:
| Q |
284 |
gtggagttgggtcgactttggggaagagttcggggtgttcttctttgtagcgtttcttagcgagtcgttgtctttggctcaccatttttgctgattggtt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462054 |
gtggagttgggtcgactttggggaagagttcggggtgttcttctttgtagcgtttcttagcgagtcgttgtctttggctcaccatttttgctgattggtt |
45461955 |
T |
 |
| Q |
384 |
gctctgaaattaggtttcgaagggtttaagtctgcaacagttcctttgcggctgcgctgtggtgacgagatgaaacaaatccaaaaggg |
472 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45461954 |
gctctgaaattaggtttcgaagggtttaagtctgcaacagttcctttgcggctgcgctgtggtgacgagatgaaacaaatccaaaaggg |
45461866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 173; E-Value: 1e-92
Query Start/End: Original strand, 30 - 218
Target Start/End: Complemental strand, 45462308 - 45462120
Alignment:
| Q |
30 |
tttagaaccaccatcaggacaattctgagctcgatgaccgcgacggcgacaccgtaaacatatcttattcttttcccattcagctttctgagtacagaat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462308 |
tttagaaccaccatcaggacaattctgagctcgatgaccacgacgccgacaccgcaaacatatcttattcttttcccattcagctttctgagtacagaat |
45462209 |
T |
 |
| Q |
130 |
ttagcgatgtggtctaatcccttgcaaatgaaacagctgtcgccgggtttcataccgggaactcgaagggggcgttttccagttcgggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45462208 |
ttagcgatgtggtctaatcccttgcaaatgaaacagctgtcgccgggtttcataccgggaactcgaagggggcgttttccggttcgggg |
45462120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University