View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1358_low_170 (Length: 204)

Name: NF1358_low_170
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1358_low_170
NF1358_low_170
[»] chr2 (2 HSPs)
chr2 (1-89)||(40616919-40617007)
chr2 (16-77)||(40627646-40627706)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 40616919 - 40617007
Alignment:
1 atatatattagccactacttgagtattctttcaagccatagtccatgtaactggtactacaccatcatttttattcagccgtaattcat 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40616919 atatatattagccactacttgagtattctttcaagccatagtccatgtaactggtactacaccatcatttttattcagccgtaattcat 40617007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 77
Target Start/End: Original strand, 40627646 - 40627706
Alignment:
16 tacttgagtattctttcaagccatagtccatgtaactggtactacaccatcatttttattca 77  Q
    |||||||||| | ||| ||||||||| |||||||||||||||||||||||||| | ||||||    
40627646 tacttgagtaattttt-aagccatagaccatgtaactggtactacaccatcatctgtattca 40627706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University