View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_172 (Length: 203)
Name: NF1358_low_172
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_172 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 20633203 - 20633273
Alignment:
| Q |
1 |
tcggaccggaagttacattaaatctatatgtaaattgagattgaaagattctagctgtcatataaggaact |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20633203 |
tcggaccggaagttacattaaatctatatgtaaattgagattgaaagattctagctgtcatataaggaact |
20633273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 20649302 - 20649372
Alignment:
| Q |
1 |
tcggaccggaagttacattaaatctatatgtaaattgagattgaaagattctagctgtcatataaggaact |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20649302 |
tcggaccggaagttacattaaatctatatgtaaattgagattgaaagattctagctgtcatataaggaact |
20649372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University