View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_177 (Length: 202)
Name: NF1358_low_177
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_177 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 35 - 100
Target Start/End: Complemental strand, 2246525 - 2246460
Alignment:
| Q |
35 |
gtacaagctttttcatgtgtgtaacacttcatagtttctgatgcaggaagtaattttctcaatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2246525 |
gtacaagctttttcatgtgtgtaacacttcatagttttttatgcaggaagtaattttctcaatgtt |
2246460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University