View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_91 (Length: 333)
Name: NF1358_low_91
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 169 - 329
Target Start/End: Complemental strand, 39276383 - 39276217
Alignment:
| Q |
169 |
aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggtgga------aagtaacaactaaca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
39276383 |
aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggaaaatactagtagtaacaactaaca |
39276284 |
T |
 |
| Q |
263 |
acctactattgaatacacttttggatctaactagtataactaacatttatgtctagtataatctacc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
39276283 |
acctactattgaatacacttttggatctaactagtataactaacatttatgtctaatagaatctacc |
39276217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 48 - 78
Target Start/End: Complemental strand, 39276467 - 39276437
Alignment:
| Q |
48 |
ttagtttagttggttccttcacacaagccat |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39276467 |
ttagtttagttggttccttcacacaagccat |
39276437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University