View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1358_low_91 (Length: 333)

Name: NF1358_low_91
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1358_low_91
NF1358_low_91
[»] chr3 (2 HSPs)
chr3 (169-329)||(39276217-39276383)
chr3 (48-78)||(39276437-39276467)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 169 - 329
Target Start/End: Complemental strand, 39276383 - 39276217
Alignment:
169 aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggtgga------aagtaacaactaaca 262  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |       ||||||||||||||    
39276383 aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggaaaatactagtagtaacaactaaca 39276284  T
263 acctactattgaatacacttttggatctaactagtataactaacatttatgtctagtataatctacc 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||    
39276283 acctactattgaatacacttttggatctaactagtataactaacatttatgtctaatagaatctacc 39276217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 48 - 78
Target Start/End: Complemental strand, 39276467 - 39276437
Alignment:
48 ttagtttagttggttccttcacacaagccat 78  Q
    |||||||||||||||||||||||||||||||    
39276467 ttagtttagttggttccttcacacaagccat 39276437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University