View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1358_low_95 (Length: 329)
Name: NF1358_low_95
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1358_low_95 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 13 - 329
Target Start/End: Complemental strand, 24879904 - 24879588
Alignment:
| Q |
13 |
aatatgcaacaatattataaaaagtgcaaaaatatgaagagaatcttaaaatagtccatgcctcttcgaacttaaccaaaggtcttgggttagaattgag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24879904 |
aatatgcaacaatattataaaaagtgcaaaaatatgaagagaatcataaaatggttcgtgcctcttcgaacttaaccaaaggtcttgggttagaattgag |
24879805 |
T |
 |
| Q |
113 |
ccctgatcagtagtccattgtagtcctacccgactcgagggttagtctttgcagtcttacccgattcgaaggattagtctttgcagttgcgtaaagagga |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||| |
|
|
| T |
24879804 |
ccctgatcagcagtccattgtagtcctatccgactcgagggttagtctttgcagtcttacccgactcgaaggattagtcttcgcagttgcgtatagagga |
24879705 |
T |
 |
| Q |
213 |
tacccgatttgcaccaaatatatgaagagaatcatttaagcatcccttggaaaatcaaaagggctccaattaccaattaacaagtctgcatcatgaattt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24879704 |
tacccgatttgcaccaaatatatgaagagaatcatttaagcatcccttggaaaatcaaaagggctccaattaccaattaacaagtctgcatcatgaattt |
24879605 |
T |
 |
| Q |
313 |
gatcaggaccaagaaat |
329 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24879604 |
gatcaggaccaagaaat |
24879588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 230
Target Start/End: Original strand, 40294727 - 40294779
Alignment:
| Q |
178 |
tcgaaggattagtctttgcagttgcgtaaagaggatacccgatttgcaccaaa |
230 |
Q |
| |
|
||||||||||||||| ||||||||| | | |||||||||||||| ||||||| |
|
|
| T |
40294727 |
tcgaaggattagtctccgcagttgcgcacaaaggatacccgatttacaccaaa |
40294779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University