View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_high_19 (Length: 220)
Name: NF13591_high_19
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_high_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 36 - 220
Target Start/End: Complemental strand, 34021706 - 34021522
Alignment:
| Q |
36 |
atcaccaccatgcctgatgcaaaaggcaagaatatatatacttagatcatataagtgttgggaataaagatctaatgttannnnnnngttaataaaagtt |
135 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
34021706 |
atcatcaccatgcctgatgcaaaaggcaagaatatatatacttagatcatataagtgttgggaataaagatataatgttatttttttgttaataaaagtt |
34021607 |
T |
 |
| Q |
136 |
tagggtatgggactcaaatcaataacttttcgaacattatactccactcgatcaacaaatttaaagatcatcatatattgctcct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34021606 |
tagggtatgggactcaaatcaataacttttcgaacattagactccactcgatcaacaaatttaaagatcatcttatattgctcct |
34021522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University