View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_low_12 (Length: 306)
Name: NF13591_low_12
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 5 - 306
Target Start/End: Original strand, 8930696 - 8930997
Alignment:
| Q |
5 |
aagagtcgaagcttctggatcctgcaacacatttctcacatacccaggcggcgctttcttatcataggcctccggtgcataaggggtcggaacaacatcg |
104 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8930696 |
aagagtcgaagcttctggatcttgcaacacatttctcacatacccaggcggcgctttcttatcataggcctccggtgcataaggggtcggaacaacatcg |
8930795 |
T |
|
| Q |
105 |
tagggaacataaggccaaaactcggctttctttcctgtatggtgcttcacccgctccaacactttgtttggctctacgtagccggttacagtgagcttgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8930796 |
tagggaacataaggccaaaactcggctttctttcctgtatggtgcttcacccgctccaacactttgtttggctctacgtagccggttacagtgagcttgc |
8930895 |
T |
|
| Q |
205 |
tttgttttggttccacttccacttttgtcactcccttcatgccttccactgatttcttcacccttctttcgcacccttcgcaatccatcttcacttttat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8930896 |
tttgttttggttccacttccacttttgtcactcccttcatgccttccactgatttcttcacccttctttcacacccttcgcaatccatcttcacttttat |
8930995 |
T |
|
| Q |
305 |
ct |
306 |
Q |
| |
|
|| |
|
|
| T |
8930996 |
ct |
8930997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 219 - 303
Target Start/End: Complemental strand, 27631008 - 27630924
Alignment:
| Q |
219 |
acttccacttttgtcactcccttcatgccttccactgatttcttcacccttctttcgcacccttcgcaatccatcttcactttta |
303 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27631008 |
acttccacttgtgtcactcctttcatcccttccactgatttcttcacttttctttcgcatccttcgcaatccatcttcactttta |
27630924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University