View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_low_13 (Length: 284)
Name: NF13591_low_13
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 50 - 284
Target Start/End: Complemental strand, 8931272 - 8931037
Alignment:
| Q |
50 |
tttatatacacgtacttttttctctattgtttatt---acttaatctaatttcagcaaccattgtcctcttggtttgtttaacaaaatatgggtgcctta |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931272 |
tttatatacacgtacttttttctctattgtttatttgtacttaatctaatttcagcaaccattgtcctcttggtttgtttaacaaaatatgggtgcctta |
8931173 |
T |
|
| Q |
147 |
gatatcatctctgagctatgtgaattctgtcacgtgcaccacggtcgtaagcttgtgaaacgcaaccaacttcaggtgaaaatattaagcattttccaac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931172 |
gatatcatctctgagctatgtgaattctgtcacgtgcaccacggtcgtaagcttgtgaaacgcaaccaacttcaggtgaaaatattaagcattttccaaa |
8931073 |
T |
|
| Q |
247 |
aaaatataatgtatactaattgtatgtttggtaaggtt |
284 |
Q |
| |
|
|||||| | || ||||||||||||||||||||||||| |
|
|
| T |
8931072 |
aaaataaactg--tactaattgtatgtttggtaaggtt |
8931037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University