View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_low_14 (Length: 248)
Name: NF13591_low_14
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 25 - 228
Target Start/End: Complemental strand, 298912 - 298709
Alignment:
| Q |
25 |
cacagaccaattgaaattgcagtctctagcttatcaccagaccttaattccagctaaccgtagagactcaatggcttctgtttctccctcttgcagcttg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298912 |
cacagaccaattgaaattgcagtctctagcttatcaccagaccttaattccagctagccgtagagactcaatggcttctgtttctccctcttgcagcttg |
298813 |
T |
 |
| Q |
125 |
tcctctcaactctagttgctccaagtaggtttggtttgcattctacatgtgctgttctttgacgtagttttgtagctcggtcaatcaatgaagttccggc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298812 |
tcctctcaactctagttgctccaagtaggtttggtttgcattctacatgtgctgttctttgacgtagttttgtagctcggtcaatcaatgaagttccggc |
298713 |
T |
 |
| Q |
225 |
ctct |
228 |
Q |
| |
|
|||| |
|
|
| T |
298712 |
ctct |
298709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 28 - 62
Target Start/End: Complemental strand, 301067 - 301033
Alignment:
| Q |
28 |
agaccaattgaaattgcagtctctagcttatcacc |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
301067 |
agaccaattgaaattgcagtctctagcttatcacc |
301033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 218
Target Start/End: Complemental strand, 301034 - 300928
Alignment:
| Q |
110 |
ccctcttgcagcttgtcctctcaactctagttgctccaagtaggtttggtttgcattctacatgtgctgttctttgacgtagttttgtagctcggtcaat |
209 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||| |||||||||||| ||||| |||||||| | ||| ||||| ||||||||| || | ||| ||| |
|
|
| T |
301034 |
ccctcttgcatcttgtcctc--aactccagttgccccaagtaggtttagtttgaattctacaagcgcttccttttgaggtagttttgcagtttggttaat |
300937 |
T |
 |
| Q |
210 |
caatgaagt |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
300936 |
caatgaagt |
300928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 61 - 194
Target Start/End: Original strand, 27465478 - 27465609
Alignment:
| Q |
61 |
ccagaccttaattccagctaaccgtagagactcaatggcttctgtttctccctcttgcagcttgtcctctcaactctagttgctccaagtaggtttggtt |
160 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||||||||||| | | ||||||||||||||||| ||||| || ||||||||||||||| ||| | |
|
|
| T |
27465478 |
ccagaccttgattccagcttgccgtagggactcaatggcttctggtacaccctcttgcagcttgtc--ctcaattccagttgctccaagtagatttaaat |
27465575 |
T |
 |
| Q |
161 |
tgcattctacatgtgctgttctttgacgtagttt |
194 |
Q |
| |
|
||||||||| | | |||| | ||||||||||||| |
|
|
| T |
27465576 |
tgcattctataagagctgctgtttgacgtagttt |
27465609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University