View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_low_18 (Length: 225)
Name: NF13591_low_18
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 51153449 - 51153260
Alignment:
| Q |
17 |
attatactccggacaaacaaccagaacaacgttgttgtctacatgtgcatataattgcactaattacggattattgaaaacatcatcataacatagttta |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51153449 |
attatattccggacaaacaaccagaacaaagttgttgtctacatgtgcatataattgcactaattacggattattgaaaacatcatcataacatagttta |
51153350 |
T |
 |
| Q |
117 |
ccacttagagtggtgtgatgacaatagcttcacaaactcaatgaccacagcaacagagttggttgcagccagtggtgagaaggtatcagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51153349 |
ccacttagagtggtgtgatgacaatagcttcacaaactcaatgaccacagcaacagagttggttgcagccagtggtgagaaggtatcagc |
51153260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 39 - 206
Target Start/End: Complemental strand, 51169376 - 51169215
Alignment:
| Q |
39 |
agaacaacgttgttgtctacatgtgcatataattgcactaattacggattattgaaaacatcatcataacatagtttaccacttagagtggtgtgatgac |
138 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||| ||||||||||||||||| ||||||||| || || | | || |||| | ||||| ||| | |
|
|
| T |
51169376 |
agaacaaagttgttgtttacatgtgcatgccattgaactaattacggattattaaaaacatcac---aaaatggatcactacttggtgtggtttga---c |
51169283 |
T |
 |
| Q |
139 |
aatagcttcacaaactcaatgaccacagcaacagagttggttgcagccagtggtgagaaggtatcagc |
206 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51169282 |
aagagcttcacaaactcaatgaccacagcaacagagttggttgcagccagtggtgagaaggtatcagc |
51169215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University