View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_low_21 (Length: 213)
Name: NF13591_low_21
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 5744525 - 5744687
Alignment:
| Q |
1 |
cagaaccgttgctgattttttgggtacctaatttctgttattagctttagagtataaattaagtaatgtgataattttttatgagaaaatcaaccatagt |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | | | | | |
|
|
| T |
5744525 |
cagaaccgttgccgattttttgggtacctaatttctgttattagctttagagtataaattaagtaatgtgataattttt--tgggtacctaa---tttcc |
5744619 |
T |
|
| Q |
101 |
taaggcttaaa-ttttttatttgtagtattctaaagtgaatt--tctcaatttgagaagcgaaatcaa |
165 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5744620 |
taaggcttaaatttttttatttgtagtattctaaagtgaatttatctcaatttgagaagcgaaatcaa |
5744687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University