View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_low_22 (Length: 209)
Name: NF13591_low_22
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 30 - 193
Target Start/End: Complemental strand, 38767117 - 38766954
Alignment:
| Q |
30 |
gtttaaattcaaatcatacaagattataatagaatataaatcatatgagtgattgaagctaaacaaagattatgaatgattacagtccaaatcgtacaac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38767117 |
gtttaaattcaaatcatacaagattataatagaatataaatcatatgagtgattgaagctaaacaaagattatgaatgattacagtccaaatcgtacaac |
38767018 |
T |
 |
| Q |
130 |
ttgtcttagtatactactatttcagaaatcagaacattaaggactttatttcttttgtaattga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38767017 |
ttgtcttagtatactactatttcagaaatcagaacattaaggactttatttcttttgtaattga |
38766954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University