View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13591_low_22 (Length: 209)

Name: NF13591_low_22
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13591_low_22
NF13591_low_22
[»] chr8 (1 HSPs)
chr8 (30-193)||(38766954-38767117)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 30 - 193
Target Start/End: Complemental strand, 38767117 - 38766954
Alignment:
30 gtttaaattcaaatcatacaagattataatagaatataaatcatatgagtgattgaagctaaacaaagattatgaatgattacagtccaaatcgtacaac 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38767117 gtttaaattcaaatcatacaagattataatagaatataaatcatatgagtgattgaagctaaacaaagattatgaatgattacagtccaaatcgtacaac 38767018  T
130 ttgtcttagtatactactatttcagaaatcagaacattaaggactttatttcttttgtaattga 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38767017 ttgtcttagtatactactatttcagaaatcagaacattaaggactttatttcttttgtaattga 38766954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University