View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13591_low_9 (Length: 366)
Name: NF13591_low_9
Description: NF13591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13591_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 5960661 - 5960317
Alignment:
| Q |
1 |
tgtggaagagtgtttaacgattgatgatagtcctttaaccaaagagtacggtgaagaggatgtggagtgggagtctcactcatttgctccatttgtgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5960661 |
tgtggaagagtgtttaacgattgatgatagtcctttaaccaaagagtacagtgaagaggatgtggagtgggagtctcactcatttgctacatttgtgaaa |
5960562 |
T |
 |
| Q |
101 |
atagggatgaaagtgccattcatacattcaaggattgtgttcatgtaatccgtattttgctttggatagttaaatctaatcaaattaccgagagtatgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960561 |
atagggatgaaagtgccattcatacattcaaggattgtgttcatgtaatccatattttgctttggatagttaaatctaatcaaattaccgagagtatgat |
5960462 |
T |
 |
| Q |
201 |
gagccgtagaagaactggaaatctatcttcatggtagtgtgttgccatctttggtcttggcaaaacaagtatatctttgaaaagggatttaaacgcccta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960461 |
gagccgtagaagaactggaaatctatcttcatggtagtgtgttgccatctttggtcttggcaaaacaagtatatctttgaaaagggatttaaacgcccta |
5960362 |
T |
 |
| Q |
301 |
acaatccgattcatgtgattttcaatatcgctaaggacatggatt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
5960361 |
acaatccgattcatgtgattttcaatatggctaaggaaatggatt |
5960317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University