View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13594_low_10 (Length: 227)
Name: NF13594_low_10
Description: NF13594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13594_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 41085205 - 41085355
Alignment:
| Q |
7 |
aaaggatagatgcagccgaagcacaaaactttattcgatgtatatatatccattaatataaataatttctatagctagcattctatctttcacttcatga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41085205 |
aaaggatagatgcagccgaagcacaaaactttattcgatgtatatatatccattaatataaataatttctatagctagcattctatctttcacttcatga |
41085304 |
T |
|
| Q |
107 |
tagaatgcagccgtatttaattatctctcgtaatttttgctctcctctgtc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41085305 |
tagaatgcagccgtatttaattatctctcgtaatttttgctctcctctgtc |
41085355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University