View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13594_low_9 (Length: 236)
Name: NF13594_low_9
Description: NF13594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13594_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 21443897 - 21443764
Alignment:
| Q |
13 |
tgggattttagaaaaccagtgatcaattgaattgaaaggaaaccgagttgttggaacttgaaatgaagctgtttttatgaattttctccgaccatggttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21443897 |
tgggattttagaaaaccagtgatcaattgaattgaagggaaaccgagttgttggaacttgaaatgaagctgtttttatgaattttctccgaccatggttg |
21443798 |
T |
|
| Q |
113 |
aaatctcataggaaatgaagatttgcagcactgt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21443797 |
aaatctcataggaaatgaagatttgcagcactgt |
21443764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 50012561 - 50012694
Alignment:
| Q |
13 |
tgggattttagaaaaccagtgatcaattgaattgaaaggaaaccgagttgttggaacttgaaatgaagctgtttttatgaattttctccgaccatggttg |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50012561 |
tgggattttagaaaatcagtgatcaattgaattgaagggaaaccgagttgttggaacttgaaatgaagctgtttttatgaattttctccgaccatggttg |
50012660 |
T |
|
| Q |
113 |
aaatctcataggaaatgaagatttgcagcactgt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
50012661 |
aaatctcataggaaatgaagatttgcagcactgt |
50012694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 15 - 145
Target Start/End: Original strand, 42066742 - 42066872
Alignment:
| Q |
15 |
ggattttagaaaaccagtgatcaattgaattgaaaggaaaccgagttgttggaacttgaaatgaagctgtttttatgaattttctccgaccatggttgaa |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42066742 |
ggattttagaaaatcagtgatcaattgaattgaagggaaaccgagttgttgaaacttgaaatgaagctgtttttatgaattttctccaaccatggttgaa |
42066841 |
T |
|
| Q |
115 |
atctcataggaaatgaagatttgcagcactg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42066842 |
atctcataggaaatgaagatttgcagcactg |
42066872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University