View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13595_high_3 (Length: 305)
Name: NF13595_high_3
Description: NF13595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13595_high_3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 5 - 305
Target Start/End: Original strand, 6503384 - 6503684
Alignment:
| Q |
5 |
ggtagattattctcaacgaaaaaatcattatcttccaatttctcgatcgctttcggttgatttgttcgcttgaaatttcctcgaacacctttagtcctca |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6503384 |
ggtagataattctcaacgaaaaaatcattatcttccaatttctcgatcgctttcggttgatttgttcgcttgaaatttcctcgaacacctttagtcctca |
6503483 |
T |
 |
| Q |
105 |
tcaccagcagttgtggatttagctcctgttccggcactggcgaagaaaattctgcagaagtaaccgctgccgtgtttacttcagattcactcctaatttt |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6503484 |
tcaccggcagttgtggatttagctcctgttccggcactggcgaagaaaattctgcagaagtaactgctgccgtgtttacttcagattcactcctaatttt |
6503583 |
T |
 |
| Q |
205 |
cttcttcctcacagccggttgccgatgcggatttagctccggttccggcaccagagaggaaaattccgcagaagtcaccgctgccacgttttccatagat |
304 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6503584 |
cttcttcctcgcagccggttgccgatgcggattaagctccggttccggcaccagagaggaaaattccgcagaagtcactactgccacgttttccatagat |
6503683 |
T |
 |
| Q |
305 |
g |
305 |
Q |
| |
|
| |
|
|
| T |
6503684 |
g |
6503684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University