View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13596_low_4 (Length: 338)
Name: NF13596_low_4
Description: NF13596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13596_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 31722823 - 31723137
Alignment:
| Q |
1 |
caagatacaaacaaatgtgcgttcgtttcttccggttgctttgggtttctatttttagattaaactagagcttaaaattgtgcaatgctcgagtaaaata |
100 |
Q |
| |
|
|||||||||||| ||| ||| ||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31722823 |
caagatacaaacgaatttgcattcttttcttccggttgctttgagtttctatttttagattaaactagagcttaaaattgtgcaatgctcgagtaaaata |
31722922 |
T |
 |
| Q |
101 |
tgcttggaacgaaata-ttttttggagcatgacatttgaccaccctatctttttcatacactcgtttaacgctgtattgtatttctatctctctctacct |
199 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
31722923 |
tgcttggaatgaaatatttttttggagcatgacatttgaacaccctgtctttttcatacactcgtttaacggtgtattgtatctcta--tctctctacct |
31723020 |
T |
 |
| Q |
200 |
atcatatatattgtatcattttattttcctcttcatttcaaagtgtatacgcggggcatatacaaaatatttttctannnnnnnnnatcataatattatt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31723021 |
atcatatatattgtatcattttattttcctcttcatttcaaagtgtatacgcggggcatatacaaaatatttttcta--tttttttatcataatattatt |
31723118 |
T |
 |
| Q |
300 |
tttaagatacaaatgatat |
318 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31723119 |
tttaagatacaaatgatat |
31723137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University