View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13597_high_6 (Length: 375)
Name: NF13597_high_6
Description: NF13597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13597_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 1180061 - 1180262
Alignment:
| Q |
18 |
gattgcattgcagaagaggtggtaaccgcgtgatcggagagtgttgagcattgaatcgaattctctgttggggattgaattcaccaccgtgacggcgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1180061 |
gattgcattgcagaagaggtggtaaccgcgtgatcggagagtgttgagcattgaatcgaattctctgttggggattgaattcaccaccgtgacggcgtta |
1180160 |
T |
 |
| Q |
118 |
gcaacaagaagaagaagcaccataagaggaaaaatcgaactcattttttcaagatttcttcacgcacaagaaagatgaacaagattgaaactgttactgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1180161 |
gcaacaagaagaagaagcaccataagaggaaaaatcgaactcattttttcaagatttcttcacgcacaagaaagatgaacaagattgaaactgttactgt |
1180260 |
T |
 |
| Q |
218 |
ta |
219 |
Q |
| |
|
|| |
|
|
| T |
1180261 |
ta |
1180262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 279 - 364
Target Start/End: Original strand, 1180322 - 1180407
Alignment:
| Q |
279 |
gttatatttattggaaatttcaacctttcttattgttgggcttgggctttcctttttgggttacttctatcttcacgggcttctgt |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1180322 |
gttatatttattggaaatttcaacctttcttattgttgggcttgggctttcctttttgggttacttctatcttcatgggcttctgt |
1180407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University