View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13597_high_7 (Length: 263)
Name: NF13597_high_7
Description: NF13597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13597_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 19937188 - 19937383
Alignment:
| Q |
1 |
gttgtggctgagattgcaagttggttagctctgtaaagaccggacttgagtgctgagtcggaatagcttcctctgtagcagctggccgagaaacaggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19937188 |
gttgtggctgagattgcaagttggttagctctgtagggatcagacttgagtgctgagtcggaatagcttcctctgtagcagctggccgagaaataggttg |
19937287 |
T |
|
| Q |
101 |
ttggaaggctgcagatgagcctatacctgaagggttatccttaagaggaacccattcagtcctctgtgttggcatttgcttcttaccctgagcaac |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19937288 |
ttggaaagctgcagatgagcctatacctgaagggttgtccttaagaggaacccattcagtcctctgtgttggcatttgcttcttaccctgagcaac |
19937383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 251
Target Start/End: Original strand, 19937419 - 19937456
Alignment:
| Q |
214 |
gtggatgaatccaccgacaaactgaaacatgatgccct |
251 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19937419 |
gtggatgaatccaccgacaaactgaaatatgatgccct |
19937456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 2 - 195
Target Start/End: Complemental strand, 8478997 - 8478801
Alignment:
| Q |
2 |
ttgtggctgagattgcaagttggttagctctgtaaagaccggacttgagtgctgagtcggaatagcttcctctgtagcagctggccgagaaacaggttgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8478997 |
ttgtggctgagattgcaagttggttagctctgtagggactggacttgagttctgagtcggaatagcttccttggtagcagctggccgagaaacaggttgt |
8478898 |
T |
|
| Q |
102 |
tggaaggctgcagatgagcctatacctgaagggttatccttaagaggaacccattc---agtcctctgtgttggcatttgcttcttaccctgagcaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
8478897 |
tggaaggctgcagatgagcctatacctgaagggttgtccttaagaggaacccattcatgagtcctctgtgttggcattggcttcttcccctgagcaa |
8478801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 8478764 - 8478727
Alignment:
| Q |
214 |
gtggatgaatccaccgacaaactgaaacatgatgccct |
251 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8478764 |
gtggatgaatccaccgacaaactgaaatatgatgccct |
8478727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University