View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13597_high_9 (Length: 210)
Name: NF13597_high_9
Description: NF13597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13597_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 91 - 188
Target Start/End: Complemental strand, 31102947 - 31102850
Alignment:
| Q |
91 |
gtttaccttcttaatggaagctttctcaacgagtttcttgacaaacatttctttgagagaatcagagatattgaaaaggttgtttgtttgtttagtac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102947 |
gtttaccttcttaatggaagctttctcaacgagtttcttgacaaacatttctttgagaggatcagagatattgaaaaggttgtttgtttgtttagtac |
31102850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University