View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13597_high_9 (Length: 210)

Name: NF13597_high_9
Description: NF13597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13597_high_9
NF13597_high_9
[»] chr8 (1 HSPs)
chr8 (91-188)||(31102850-31102947)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 91 - 188
Target Start/End: Complemental strand, 31102947 - 31102850
Alignment:
91 gtttaccttcttaatggaagctttctcaacgagtttcttgacaaacatttctttgagagaatcagagatattgaaaaggttgtttgtttgtttagtac 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
31102947 gtttaccttcttaatggaagctttctcaacgagtttcttgacaaacatttctttgagaggatcagagatattgaaaaggttgtttgtttgtttagtac 31102850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University