View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13598_high_8 (Length: 309)
Name: NF13598_high_8
Description: NF13598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13598_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 7 - 291
Target Start/End: Original strand, 4776053 - 4776337
Alignment:
| Q |
7 |
gtgagatgaagtccattggagatggtggatttgagatagcgcaatactctatttaaggcttgcatatctgtcacagtaggagcttgcatttgttgtgcta |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4776053 |
gtgagatggagtccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagcttgcatttgttatgcta |
4776152 |
T |
 |
| Q |
107 |
gtttattcaccgggaatgctatgtccgggcgtgtgattgaaaggtaatgtaaggcaccaagtatactgcgaaattccttactatcacagtatgtggagtc |
206 |
Q |
| |
|
|||||||||| || ||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4776153 |
gtttattcactggaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattccttactgtcacagtatgtggagtc |
4776252 |
T |
 |
| Q |
207 |
aggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcaatcacccatgtttgcacgaaggagaatatct |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
4776253 |
gggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcagtcgcccatgtttgctcgaaggagaatatct |
4776337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University