View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13598_low_11 (Length: 273)
Name: NF13598_low_11
Description: NF13598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13598_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 37984433 - 37984191
Alignment:
| Q |
18 |
catctttggtaagtaaaactttttcaccaaattaactccttttgtaacaa--aatttattgatttggtaacattttgttaattgttgctgtagttttgtc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37984433 |
catctttggtaagtaaaactttttcaccaaattaactccttttgtttttatgagcttattgatttggtaacattttgttaattgttgctgtagttttgtc |
37984334 |
T |
 |
| Q |
116 |
agcattggataacatgggttttgtgacaaacatggtgagcttagtactatactttattggagtgatgcactttgatctttcaagctctgccaacactttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37984333 |
agcattggataacatgggttttgtgacaaacatggtgagcttagtactatactttattggagtgatgcactttgatctttcaagctctgccaacactttg |
37984234 |
T |
 |
| Q |
216 |
acaaattttatgggctcaactttcttgctctctcttgttggtg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37984233 |
acaaattttatgggctcaactttcttgctctctcttgttggtg |
37984191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 104 - 258
Target Start/End: Original strand, 45659196 - 45659350
Alignment:
| Q |
104 |
tgtagttttgtcagcattggataacatgggttttgtgacaaacatggtgagcttagtactatactttattggagtgatgcactttgatctttcaagctct |
203 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |||||||||| |||||||| ||||| ||| ||||||||||||||||||| | |||| ||| |
|
|
| T |
45659196 |
tgtagtattgtcagcattggacaacatgggttttgtggcaaacatggttagcttagttctatatttttatggagtgatgcactttgatataccaagttct |
45659295 |
T |
 |
| Q |
204 |
gccaacactttgacaaattttatgggctcaactttcttgctctctcttgttggtg |
258 |
Q |
| |
|
|| || ||| | ||||| || ||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
45659296 |
gcaaatactctcacaaacttcatgggttcaactttcttgctttctctagttggtg |
45659350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University