View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_high_33 (Length: 314)
Name: NF1359_high_33
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_high_33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 93 - 314
Target Start/End: Original strand, 12690394 - 12690615
Alignment:
| Q |
93 |
cttataacatggaattcaaaattaatatacacgaactccaactaaatggattttttgatacttcaactactctccgaatatcataaaaaatataatatcg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12690394 |
cttataacatggaattcaaaattaatatacacgaactccaactaaatagattttttgatacttcaactactctccgaatatcataaaaaatataatatcg |
12690493 |
T |
 |
| Q |
193 |
tgttcacacacaaaaaaccaataacatttgcaacattatttatggtctctttatcaataacatttcaactgcaatgtatttgatggggttgtgtagcata |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12690494 |
tgttcacacacaaaaaaccaataacatttgcaacattatttatggtctctttatcaataacatttcaactgcaatgtatttgatggggttgtgtagcgta |
12690593 |
T |
 |
| Q |
293 |
gcactctttcaatccaatcaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12690594 |
gcactctttcaatccaatcaat |
12690615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University