View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_high_48 (Length: 256)
Name: NF1359_high_48
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 53955871 - 53956116
Alignment:
| Q |
1 |
atataagattaaagatgcaaatgaatacataagttataa-gtactagtgatcataataacatggttatttcagtaaaattggagctcatattttgcaaaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53955871 |
atataagattaaagatgcaaatgaatacataagttataaagtactagtgatcataataacatggttatttcagtaaaattggagctcatattttgcaaaa |
53955970 |
T |
 |
| Q |
100 |
gaagtagaaatcttgagcatatgattgatggtagtggcccatgtcttgtaacgacgaagatcatccaccatgtctagcttgaaagtgccttttcttgttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53955971 |
gaagtagaaatcttgagcatatgattgatggtagtggcccatgtcttgtaacgacgaagatcatccaccatgtctagcttgaaagtgccttttcttgttg |
53956070 |
T |
 |
| Q |
200 |
ccaaaacaatcagataacatgtatcatcctcggtttctgaaccttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53956071 |
ccaaaacaatcagataacatgtatcatcctcggtttctgaaccttt |
53956116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University