View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_high_6 (Length: 561)
Name: NF1359_high_6
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 529; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 529; E-Value: 0
Query Start/End: Original strand, 1 - 549
Target Start/End: Original strand, 19395856 - 19396404
Alignment:
| Q |
1 |
catcgtcgtccgcaacagcatcagcatcagcatcgggagtgggagcatgtgcatctgttttaccccaaggtaatttgaatcctgaaagtccaccttgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19395856 |
catcgtcgtccgcaacagcatcagtatcagcatcgggagcgggagcatgtgcatctgatttaccccaaggtaatttgaatcctgaaagtccaccttgaaa |
19395955 |
T |
|
| Q |
101 |
tgcattaacaatttgagaaacctgtgaaacaacagcgagggagttgctcagaagttgccttgattcagcaaatatcatctccatctttttcttcaattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19395956 |
tgcattaacaatttgagaaacctgtgaaacaacagcgagggagttgctcagaagttgccttgattcagcaaatatcatctccatctttttcttcaattct |
19396055 |
T |
|
| Q |
201 |
ccttccgggaaaccgtcagaacaagtgtcttggtaagatataacagcactaagccaattgttcaactcagcttcttttgaagctagtttgctaatatcaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396056 |
ccttccgggaaaccgtcagaacaagtgtcctggtaagatataacagcactaagccagttgttcaactcagcttcttttgaagctagtttgctaatatcaa |
19396155 |
T |
|
| Q |
301 |
gttgcccgacttcagtgatcgagaatcccatttcttctttagcatcctcaaacaactgtttacaatcttcataagctcccttttcttccttggaagcgaa |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396156 |
gttgcccgacttcagtgatcgagaatcccatttcttctttagcatcctcaaacaactgtttacaatcttcataagctcccttttcttccttggaagcgaa |
19396255 |
T |
|
| Q |
401 |
tttcaagttcgcggttttgttgaatgcgttgttaatttcattcttggcaactagcatgaaaaccattagaagaccctttggttctttcaatttagggtct |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396256 |
tttcaagttcgcggttttgttgaatgcgttgttaatttcattcttggcaactagcatgaaaaccattagaagaccctttggttctttcaatttagggtct |
19396355 |
T |
|
| Q |
501 |
tttttcaatgcctctttaagtgtggttacacatttttccttgtattctg |
549 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396356 |
tttttcaatgcctctttaagtgtggttacacatttttccttgtattctg |
19396404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University