View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_22 (Length: 385)
Name: NF1359_low_22
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 47460159 - 47460454
Alignment:
| Q |
1 |
ccgttgacgacttttacttctctgttgtctccgacgatgaaattgaccctaacgtccctgtctccgatgacaagtacgctgaagcattacagtttcaaga |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47460159 |
ccgtagacgacttttacttctctgttgtctccgacgatgaaattgaccctaacgttcctgtctccgatgacaagtacgctgaagcattacagtttcaaga |
47460258 |
T |
|
| Q |
101 |
aaccttattggcctctgtcatcacttctcaccaaaacccttcatcctcttccttcttggcaccaccacgttcattaccatgcgtagcatcttcatcaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47460259 |
aaccttattggcctctgtcatcacttctcaccaaaacccttcatcctcttccttcttggcaccaccacattcattaccatgcgtagcatcttcatcaaaa |
47460358 |
T |
|
| Q |
201 |
acggtttctgaagagttacagtttcaccaaacccttatgcagtcaccaccgttgcactgcgtagcatcttcgtcaaagtctattgaagttggcatt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47460359 |
acggtttctgaagagttacagtttcaccaaacccttatgcagtcaccaccgttgcactgtgtagcatcttcgtcaaagtctattgaagttggcatt |
47460454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 59 - 246
Target Start/End: Original strand, 47466821 - 47467008
Alignment:
| Q |
59 |
tgtctccgatgacaagtacgctgaagcattacagtttcaagaaaccttattggcctctgtcatcacttctcaccaaaacccttcatcctcttccttcttg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||| || ||||||| || || |
|
|
| T |
47466821 |
tgtctccgatgacaagtacgctgaagcattacagttccaagaaaccttaatggcctctgccatcacttctcaccaaaaccactcgtcctctttctcctct |
47466920 |
T |
|
| Q |
159 |
gcaccaccacgttcattaccatgcgtagcatcttcatcaaaaacggtttctgaagagttacagtttcaccaaacccttatgcagtcac |
246 |
Q |
| |
|
||||||||| | || || |||||||| |||||||||||||| || ||| ||||||| ||| || ||||||||||| |||||| |
|
|
| T |
47466921 |
tcaccaccaccattttttccgtgcgtagcgtcttcatcaaaaactgtcgatgatgagttactgttcaacgaaacccttatgaagtcac |
47467008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University