View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_25 (Length: 366)
Name: NF1359_low_25
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 4 - 359
Target Start/End: Complemental strand, 2564353 - 2564008
Alignment:
| Q |
4 |
aaattttcatgaaaatttgttgacacaattttggtccaacagcagaagaacttgatgcaacaacttgcagtatactatgtctgaggacttgtatacaaac |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||| | | ||| ||||| |
|
|
| T |
2564353 |
aaattttcatgaaa-tttgttgacacaattttggtccagcagcagaagaacttgatgcaacaacttg-ag------atgaaacaaaccaagta--caaac |
2564264 |
T |
 |
| Q |
104 |
ccatgtgcattgtgcactagcctcacaaatcattgcccgtggtcccaagaaaagatatatctttctcgactgggcaactaaccactaggtaggtatacat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564263 |
ccatgtgcattgtgcactagcctcacaaatcattgcccgtggtcccaagaaaagatatatctttctcgactgggcaactaaccactaggtaggtatacat |
2564164 |
T |
 |
| Q |
204 |
gtgttgcccacaatttgttcatttttcaaaccaaagctcgtcaagtgtctttagaattagagagaaaatctatcacctcttgcagtgcaaatatagagta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564163 |
gtgttgcccacaatttgttcatttttcaaaccaaagctcgtcaagtgtctttagaattagagagaaaatctatcacctcttgcagtgcaaatatagagta |
2564064 |
T |
 |
| Q |
304 |
tatacacactagatatgtatgattgttacgcgctatgcagataccgagaataatct |
359 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
2564063 |
tatacacactagatatgtatgattcttacgcgctatgcagatacagagaataatct |
2564008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University