View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_27 (Length: 355)
Name: NF1359_low_27
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 81 - 263
Target Start/End: Complemental strand, 1866032 - 1865850
Alignment:
| Q |
81 |
gagatgaactactacctgcattgattaattcaaactatactttgtaactaagaatacatttttatatgtaacaattgaaaaatgggtcacattaatccac |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1866032 |
gagatgaactactacctgcattgattaattcaaactatactttgtaactaagaatacatttttatatgtaacaattgaaaaatgggtcacattaatccac |
1865933 |
T |
 |
| Q |
181 |
ataaacataagagagaatacatacctaaaaacaaagaagcatgagaagactcttctggaaagctaaaatttctagacaatagt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1865932 |
ataaacataagagagaatacatacctaaaaacaaagaagcatgagaagactcttctggaaagctaaaatttctagacaatagt |
1865850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University