View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_28 (Length: 354)
Name: NF1359_low_28
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_28 |
 | |
|
| [»] scaffold0038 (3 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 8e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 16978511 - 16978411
Alignment:
| Q |
84 |
gatgaagatgatatgggtttggatcattatgtttctcgttgtaagagaatgaaggtaaaaagagaaacttttgttcttcctaagaatgttaaggttattt |
183 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16978511 |
gatgaagatgatatgggtttggatcactatgtttctcgttgtaagaaaatgaaggtaaaaagagaaacttttgttcttcctaagaatgttaaagttattt |
16978412 |
T |
|
| Q |
184 |
c |
184 |
Q |
| |
|
| |
|
|
| T |
16978411 |
c |
16978411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 256 - 292
Target Start/End: Original strand, 29063 - 29099
Alignment:
| Q |
256 |
tgtcaacagagataatgtaaatatgtaattttaatta |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29063 |
tgtcaacagagataatgtaaatatgtaattttaatta |
29099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 267 - 323
Target Start/End: Original strand, 47241 - 47297
Alignment:
| Q |
267 |
ataatgtaaatatgtaattttaattatgtgtgcgtacttattttgttacatattatc |
323 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| || ||||| |||||||||||||| |
|
|
| T |
47241 |
ataatgtaaatatctaattttaattctgtgtgcttatttattatgttacatattatc |
47297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 255 - 291
Target Start/End: Original strand, 40184 - 40220
Alignment:
| Q |
255 |
gtgtcaacagagataatgtaaatatgtaattttaatt |
291 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40184 |
gtgtcaacactgataatgtaaatatgtaattttaatt |
40220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 256 - 292
Target Start/End: Original strand, 28228565 - 28228601
Alignment:
| Q |
256 |
tgtcaacagagataatgtaaatatgtaattttaatta |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28228565 |
tgtcaacagagataatgtaaatatgtaattttaatta |
28228601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 267 - 323
Target Start/End: Original strand, 28247079 - 28247135
Alignment:
| Q |
267 |
ataatgtaaatatgtaattttaattatgtgtgcgtacttattttgttacatattatc |
323 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| || ||||| |||||||||||||| |
|
|
| T |
28247079 |
ataatgtaaatatctaattttaattctgtgtgcttatttattatgttacatattatc |
28247135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 255 - 291
Target Start/End: Original strand, 28240022 - 28240058
Alignment:
| Q |
255 |
gtgtcaacagagataatgtaaatatgtaattttaatt |
291 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28240022 |
gtgtcaacactgataatgtaaatatgtaattttaatt |
28240058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University