View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_47 (Length: 290)
Name: NF1359_low_47
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 38438539 - 38438400
Alignment:
| Q |
16 |
attccaggtagcaaataatttatatacttcaacatagtctttaaaattgataatctttaatgaaattaaa------------------agtatttattta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
38438539 |
attccaggtagcaaataatttatatacttcaacatagtctttaaaattgataatctttaatcaaattaaaagtaacgtggagctgaaaagtatttatttt |
38438440 |
T |
 |
| Q |
98 |
tattctgaagttaattaatagaatgaaagacaatgaaatt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38438439 |
tattctgaagttaattaatagaatgaaagacaatgaaatt |
38438400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University