View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_50 (Length: 270)
Name: NF1359_low_50
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 4 - 123
Target Start/End: Complemental strand, 48203361 - 48203242
Alignment:
| Q |
4 |
tccaaaccaaagaaagcaaaagcttgctatttcttctcccacttctaatttttcccttaggactttgcaggcagaggaaaccctctcagtcttcactctt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203361 |
tccaaaccaaagaaagcaaaagcttgctatttcttctcccacttctaatttttccctcaggactttgcaggcagaggaaaccctctcagtcttcactctt |
48203262 |
T |
 |
| Q |
104 |
cgttcaaattccagaatcct |
123 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48203261 |
cgttcaaattccagaatcct |
48203242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 190 - 259
Target Start/End: Complemental strand, 48203174 - 48203105
Alignment:
| Q |
190 |
tgaatgtttgtttgtcatgggaaggagagtacctcttggcaacatctcattaatacacccatttcttcat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48203174 |
tgaatgtttgtttgtcatgggaaggagagtacctcttggtaacatctcattaatacacccatttcttcat |
48203105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University