View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_57 (Length: 256)
Name: NF1359_low_57
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 6998355 - 6998109
Alignment:
| Q |
1 |
ccagagccaagaaaccatacctctttttgagcactactactcaaatcagctttagccaagagacacatctcttctcggccgtcatcaaattcagcataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6998355 |
ccagagccaagaaaccatacctctttttgagcactaatactcaaatcagctttagccaagagacacatctcttctcggccgtcatcaaattcagcataat |
6998256 |
T |
 |
| Q |
101 |
ttgaattttcttcccagttgggacactcattatgattgtgtcctagcttatgaagaagtttgatgtcatttgaggatttgtgttacttagtggtagcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
6998255 |
ttgaattttcttcccagttgggacactcattatgatagtgtcctagcttatgaagaagtttgatgtcaattgaggatttgtgttgcttagtggtagcatt |
6998156 |
T |
 |
| Q |
201 |
tccagtagcgactgtgacaccattttcaatcaaactccaatattctt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6998155 |
tccagtagcgactgtgacaccattttcaatcaaactccaatattctt |
6998109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University