View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_61 (Length: 251)
Name: NF1359_low_61
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 38438672 - 38438915
Alignment:
| Q |
1 |
taatattatggaaaataaggtcaaatgtgattgatgcggcctcaattatggttttgacaacttaaaacccttatattgtggccccgattgcagttgcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38438672 |
taatattatggaaaataaggtcaaatgtgattgatgcggcctcaattatggtttcgacaacttaaaaccctaatattgtggccccgattgcagttgcaga |
38438771 |
T |
 |
| Q |
101 |
cctttatttaaaaccctgcgtgacgcctttagcggtaaaaattggtgatttactcactaaaaatattttgtcacagtaccctcaagtctatgttcatgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38438772 |
cctttatttaaaaccctgcgtgacgtctttagcggtaaaaattggtgatttactcactaaaaatattttgtcacagtaccctcaagcctatgttcatgaa |
38438871 |
T |
 |
| Q |
201 |
atgtttgttgaaagtccaaagtaagtaagtaggtacctttgttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38438872 |
atgtttgttgaaagtccaaagtaagtaagtaggtacctttgttt |
38438915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 115
Target Start/End: Original strand, 14617038 - 14617082
Alignment:
| Q |
71 |
ttatattgtggccccgattgcagttgcagacctttatttaaaacc |
115 |
Q |
| |
|
|||||||| ||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
14617038 |
ttatattgcggcccagattgcagttgcggacttttatttaaaacc |
14617082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University