View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_69 (Length: 237)
Name: NF1359_low_69
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_69 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 25617483 - 25617376
Alignment:
| Q |
1 |
gatggtgattttatagatcatatataatttcagtacccttactgcaattgagtgttcaagtctccttaagcactaattggacgaaagatggtacggcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
25617483 |
gatggtgattttatagatcatatataatttcagtaccctt-ctgcaattgagtgttcaagtctccttaagcactcattggatgaaagatggtacggcaaa |
25617385 |
T |
|
| Q |
101 |
gtgttatat |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
25617384 |
gtgttatat |
25617376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 237
Target Start/End: Complemental strand, 34541624 - 34541581
Alignment:
| Q |
194 |
gggtaataatctatttttcttccttttattttcttatattttct |
237 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
34541624 |
gggtaataatctatttctcttcattttattttcttatagtttct |
34541581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University