View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_74 (Length: 213)
Name: NF1359_low_74
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 81 - 185
Target Start/End: Complemental strand, 41794405 - 41794298
Alignment:
| Q |
81 |
aatattagttaaaaacgcatccaatcagatctcatcatattgatattagagatcaaattgtgtt---tagtaatatttgttagagacttaattttggtgt |
177 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
41794405 |
aatattagttagaaacgcatccaatcagatctcatcatattgatattagagatcaaattgtgttatatagtaatatttgttagagactaaattttggtgt |
41794306 |
T |
|
| Q |
178 |
ttgttggt |
185 |
Q |
| |
|
|||||||| |
|
|
| T |
41794305 |
ttgttggt |
41794298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University