View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_77 (Length: 209)
Name: NF1359_low_77
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_77 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 7 - 193
Target Start/End: Original strand, 1877147 - 1877333
Alignment:
| Q |
7 |
atagagaggtggaggatggtttattttgttggtagctcgaaggtggattgctagtttcatttggtatcatatttttctgttagtgggaacgagtgtaatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1877147 |
atagagaggtggaggatggtttattttgttggtagctcgaaggtggattgctagtttcatttggtatcatatttttctgttagtgggaacgagtgtaatc |
1877246 |
T |
 |
| Q |
107 |
ttgcccagtattatatttttctataaagagaagtctaatgctaatttgatacaccatacaaccgtttgaaagactttaggggtatat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
1877247 |
ttgcccagtattatatttttctataaagagaagtctaatgcttatttgatacaccacacaaccgtttgaaaaattttaggggtatat |
1877333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University