View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1359_low_78 (Length: 206)
Name: NF1359_low_78
Description: NF1359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1359_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 45138505 - 45138397
Alignment:
| Q |
1 |
attctaatgaggttgttatctgattatcaatgggctactcttctcaagaccatgagaacaaatggtctcgtattttatcatatagataggatatcattgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45138505 |
attctaatgaggttgttatctgattatcaatgggctactcttctcaagaccatgcgaacaaatggtctcgtattttatcatatagataggatatcattgt |
45138406 |
T |
 |
| Q |
101 |
ttttgtcac |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
45138405 |
ttttgtcac |
45138397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University