View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13600_high_1 (Length: 305)
Name: NF13600_high_1
Description: NF13600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13600_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 7 - 165
Target Start/End: Original strand, 17124768 - 17124927
Alignment:
| Q |
7 |
ggtgtaaatattattaacaatttcttagcaattactcaaagctaacatgttctgtttggtatgcaggggatttcctgtttggctaaagtatgtaccaggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17124768 |
ggtgtaaatattattaacaatttcttagcaattactcaaagctaacaagttctgtttggtatgcaggggatttcctgtttggctaaagtatgtaccaggt |
17124867 |
T |
 |
| Q |
107 |
gttgctttcagaacagacaatgagccgttcaaggttggtgtt-ttttctgtttggtgctt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17124868 |
gttgctttcagaacagacaatgagccgttcaaggttggtgttattttctgtttggtgctt |
17124927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 229 - 305
Target Start/End: Original strand, 17124991 - 17125067
Alignment:
| Q |
229 |
ctaacaaccgtcctaattattgtcatgatgtatgttaggcggctatgcaaaaattcactaccaagattgtcagtatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17124991 |
ctaacaaccgtcctaattattgtcatgatgtatgttaggcggctatgcaaaaattcactaccaagattgtcagtatt |
17125067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 68 - 149
Target Start/End: Original strand, 5229913 - 5229994
Alignment:
| Q |
68 |
tgcaggggatttcctgtttggctaaagtatgtaccaggtgttgctttcagaacagacaatgagccgttcaaggttggtgttt |
149 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| || || | ||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
5229913 |
tgcagaggatttcctgtttggctcaagtatgttcctgggatggctttcagaacagacaatgagccatttaaggttggagttt |
5229994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 66 - 144
Target Start/End: Complemental strand, 52550405 - 52550327
Alignment:
| Q |
66 |
tatgcaggggatttcctgtttggctaaagtatgtaccaggtgttgctttcagaacagacaatgagccgttcaaggttgg |
144 |
Q |
| |
|
||||||| |||||||| |||||||| |||||||| || || |||| |||||||||||||| |||| || |||||||| |
|
|
| T |
52550405 |
tatgcagtggatttccagtttggctcaagtatgttccgggcattgcattcagaacagacaaccagccttttaaggttgg |
52550327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University