View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13600_low_6 (Length: 212)
Name: NF13600_low_6
Description: NF13600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13600_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 3376742 - 3376561
Alignment:
| Q |
18 |
aaaacatgaaaccttttccaacctcgaatccgttttctgaggtattgtctgctttgagcaaagtcgaatatggaacaaaaccattgccttgactatgaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3376742 |
aaaacatgaaaccttttccaacctcgaatccgttttctgaggtattgtttgctttgagcaaagtcgaatatggaacaaaaccattgccttgactatgaga |
3376643 |
T |
 |
| Q |
118 |
tacaagttccaaagaacctaatgttgttgatgtcaatgctacaacatgataactatctcctttattttgaggtggatgatgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3376642 |
tacaagttccaaagaacctaatgttgttgatgtcaatgctacaacatgataactatctcctttattttgaggtggatgatgt |
3376561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University