View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13601_high_10 (Length: 286)

Name: NF13601_high_10
Description: NF13601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13601_high_10
NF13601_high_10
[»] chr3 (2 HSPs)
chr3 (23-277)||(39663070-39663324)
chr3 (23-262)||(39667264-39667503)
[»] chr8 (1 HSPs)
chr8 (29-93)||(37962599-37962663)


Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 23 - 277
Target Start/End: Complemental strand, 39663324 - 39663070
Alignment:
23 tataactacttcgagcggggcaaccttgatatattcagtggtagaggtccttgtttggatggacctgtttgcaacatgaacttaacttcagacgggtcgg 122  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||    
39663324 tataactactttgagcggggcaaccttgatatattcagtggtagaggtccttgtttggatggacctgtttgcaatatgaacttgacttcagatgggtcgg 39663225  T
123 gttctcatcacggttggtattgtaattatgtggaggttaccaccactggggcccacattccctgtgctcaacaacagttcgaggtggaacagtggctagc 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
39663224 gttctcatcacggttggtattgtaattatgtggaggttaccaccactggggcccacattccctgtgctcaacagcagttcgaggtggaacagtggctagc 39663125  T
223 taccgacacatcgccatatgagctttctgctattcggaacaactgccagtataat 277  Q
    |||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||    
39663124 taccgacacatcgccatacgagctttctgctattaggaacaactgccaatataat 39663070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 23 - 262
Target Start/End: Complemental strand, 39667503 - 39667264
Alignment:
23 tataactacttcgagcggggcaaccttgatatattcagtggtagaggtccttgtttggatggacctgtttgcaacatgaacttaacttcagacgggtcgg 122  Q
    ||||||||||  || |||||||||||||||||||||||||| | ||||||||||||||| |||||||||||     | || || ||||||||||||||||    
39667503 tataactactatgaacggggcaaccttgatatattcagtggcaaaggtccttgtttggaaggacctgtttgtgcggtaaatttgacttcagacgggtcgg 39667404  T
123 gttctcatcacggttggtattgtaattatgtggaggttaccaccactggggcccacattccctgtgctcaacaacagttcgaggtggaacagtggctagc 222  Q
    || ||||||| || ||||||||||||||||| ||||||||  | ||||| |  |||||||| || ||||| |||||||| || |||||||| ||||| ||    
39667403 gtcctcatcatgggtggtattgtaattatgttgaggttacttctactggagtacacattccttgcgctcagcaacagtttgaagtggaacaatggcttgc 39667304  T
223 taccgacacatcgccatatgagctttctgctattcggaac 262  Q
    ||||||||| || || ||||||||||||||| || |||||    
39667303 taccgacacctcaccttatgagctttctgctgttaggaac 39667264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 93
Target Start/End: Complemental strand, 37962663 - 37962599
Alignment:
29 tacttcgagcggggcaaccttgatatattcagtggtagaggtccttgtttggatggacctgtttg 93  Q
    |||||||| || || ||||||||||| |||||||| ||||| |||||||| || ||||| |||||    
37962663 tacttcgaacgtggtaaccttgatattttcagtggaagaggaccttgtttagaaggacccgtttg 37962599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University