View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13601_high_13 (Length: 205)
Name: NF13601_high_13
Description: NF13601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13601_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 10 - 189
Target Start/End: Complemental strand, 3254812 - 3254634
Alignment:
| Q |
10 |
tccaagaatatctccaaaatgtaaaatttcatttgaatttaagtatgttaactagaattatcagtgtttttatttactttctagtctaatatgcaaactt |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3254812 |
tccaaggatatctccaaaatgtaaaatttcatttgaatttaagtatgttaactagaattatcagtgtttttatttactttctagtctaatatgcaaactt |
3254713 |
T |
|
| Q |
110 |
ttagtttgatagtttggacaacatattcaaactctcctccctcttcctttgttttgattctgtgtaggcaagatattatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3254712 |
ttagtttgatagtttggacaacatattcaaactct-ctccctcttcctttgttttgattctgtgtaggcaagatattatt |
3254634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 8 - 135
Target Start/End: Original strand, 7872418 - 7872545
Alignment:
| Q |
8 |
tgtccaagaatatctccaaaatgtaaaatttcatttgaatttaagtatgttaactagaattatcagtgtttttatttactttctagtctaatatgcaaac |
107 |
Q |
| |
|
||||||| |||||| ||| ||||||| |||||||| ||||||||||| | |||||| ||||||||||| | ||| |||||| || ||||||||| | |
|
|
| T |
7872418 |
tgtccaacgatatcttcaagatgtaaactttcatttaaatttaagtattgttactagatttatcagtgttatgtattagtttctattccaatatgcaacc |
7872517 |
T |
|
| Q |
108 |
ttttagtttgatagtttggacaacatat |
135 |
Q |
| |
|
|||||||| ||| |||||||||||||| |
|
|
| T |
7872518 |
gtttagtttcatactttggacaacatat |
7872545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 111
Target Start/End: Original strand, 14018865 - 14018948
Alignment:
| Q |
28 |
atgtaaaatttcatttgaatttaagtatgttaactagaattatcagtgtttttatttactttctagtctaatatgcaaactttt |
111 |
Q |
| |
|
||||||| |||||||||||||||||| | || ||||||||||| ||||||||| ||||| | || ||||||||| || ||||| |
|
|
| T |
14018865 |
atgtaaactttcatttgaatttaagtttatttactagaattattagtgtttttcgttactctttattctaatatgaaacctttt |
14018948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University