View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13602_low_1 (Length: 356)
Name: NF13602_low_1
Description: NF13602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13602_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 16 - 344
Target Start/End: Original strand, 37145566 - 37145894
Alignment:
| Q |
16 |
ctttccaccgaggaacaaacctgggcgacaaacattgaggtgattttgagtttgtcaagatatgtggttgctatgtcgggagttggtgatttggaagcaa |
115 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145566 |
ctttccactgaggaacaaacctgggcaacaaacattgaggtgattttgagtttgtcaagataggtggttgctatgtcgggagttggtgatttggaagcaa |
37145665 |
T |
 |
| Q |
116 |
tggcagcatcaattccttcatctttgagtgcactcaagatgcctctggaatggggaaacaaagaaggtgtgtcgtgcttggagcggcactcactgaaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145666 |
tggcagcatcaattccttcatctttgagtgcactcaagatgcctctggaatggggaaacaaagaaggtgtgtcgtgcttggagcggcactcactgaaatt |
37145765 |
T |
 |
| Q |
216 |
tgagattcaattggtgtagtcaaatacatgataagaaagaaagtttagtgggtactccagaaaatagtaaagatgaaaagatgtatcatgtacaaattta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145766 |
tgagattcaattggtgtagtcaaatacatgataagaaagaaagtttagtgggtactccagaaaatagtaaagatgaaaagatgtatcatgtacaaattta |
37145865 |
T |
 |
| Q |
316 |
ccagtagaaaggccaaagagtataatcta |
344 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37145866 |
ccagtagaaaggccaaagagtataatcta |
37145894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University